Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU137791

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGGGAACCCGACATTACAGATGCACCAGTTTCTTCACTTTCTAGAAGGAGGAGTAGGAGTTTGATGAAGAACAGAAGAATTTCTGGTTGTTTACATGACATACAAGTCCATCCAATTAAGAATTTGCATTCTTCACATTCATCAGGTTTAATGGACAAATCAAGCACTATTTACTCAAATTCAGCAGAGTCCTTTCTTCCTGGAATTTGCAAAGAATTGATTGGTTCTTCGTTAGATTTTTTTGGACAGAGTTATGATGAAGAAAGAACTATAGCAGACAGCCTAATTAATAGTTTTCTTAAAATTTATAATGGGCTATTTGCCATTTCCAAGGCTCATGAAGAACAAGATGAAGAAAGTCAAGATAACTTGTTTTCTTCTGATCGAGCAATCCAGTCACTTACTATTCAGACTGCATGTGCTTTTGAGC

Numéro d'accès Ensembl | humain

ENSG00000118193

Numéro d'accès NCBI

NM_014875

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KIF14(9928) , KIF14(9928)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Petra Pejskova et al.
The Journal of cell biology, 219(6) (2020-04-30)
Primary cilia play critical roles in development and disease. Their assembly and disassembly are tightly coupled to cell cycle progression. Here, we present data identifying KIF14 as a regulator of cilia formation and Hedgehog (HH) signaling. We show that RNAi
Kay Ka-Wai Li et al.
Laboratory investigation; a journal of technical methods and pathology, 97(8), 946-961 (2017-05-16)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. At present, there is no well-established targeted drug for majority of patients. The kinesin family member 14 (KIF14) is a novel oncogene located on chromosome 1q and is dysregulated
Wei Huang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1659-1670 (2015-11-05)
The mitotic kinesin superfamily protein KIF14 is essential for cytokinesis and chromosome segregation, and increased KIF14 expression is related to a variety of human cancers. However, the role of KIF14 in the development and malignant progression of astrocytomas and the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique