Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU137581

Sigma-Aldrich

MISSION® esiRNA

targeting human ASH1L

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCATTTGTTGCCACTGAAAGTCCAAGCAAGCTAGAATCTGAAAGTGACAACCATAGAAGTAGCAGTGATTTCTTTGAGAGCGAGGATCAACTTCAGGATCCAGATGACCTAGATGACAGTCATAGGCCAAGTGTCTGTAGTATGAGTGACCTTGAGATGGAACCAGATAAAAAAATTACCAAGAGAAACAATGGACAATTAATGAAAACAATTATCCGCAAAATAAATAAAATGAAGACTTTAAAGAGAAAGAAACTGTTGAATCAGATTCTTTCAAGTTCTGTAGAATCAAGTAATAAAGGGAAAGTGCAATCCAAACTCCATAATACGGTATCAAGTCTTGCTGCCACATTTGGCTCTAAATTGGGCCAACAGATAAATGTCAGCAAGAAAGGAACCATTTATATAGGAAAGAGAAGAGGTCGCAAACCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ilaria Castiglioni et al.
Nature communications, 9(1), 5026-5026 (2018-11-30)
Myoblast fusion (MF) is required for muscle growth and repair, and its alteration contributes to muscle diseases. The mechanisms governing this process are incompletely understood, and no epigenetic regulator has been previously described. Ash1L is an epigenetic activator belonging to
Arijita Subuddhi et al.
Tuberculosis (Edinburgh, Scotland), 120, 101897-101897 (2020-02-25)
The modification of chromatin influences host transcriptional programs during bacterial infection, at times skewing the balance in favor of pathogen survival. To test the role of chromatin modifications during Mycobacterium tuberculosis infection, we analysed genome-wide deposition of H3K4me3 marks in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique