Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU133691

Sigma-Aldrich

MISSION® esiRNA

targeting human CSE1L

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGATCCTGATCCTGCCATCCGACGTCCAGCTGAGAAATTTCTTGAATCTGTTGAAGGAAATCAGAATTATCCACTGTTGCTTTTGACATTACTGGAGAAGTCCCAGGATAATGTTATCAAAGTATGTGCTTCAGTAACATTCAAAAACTATATTAAAAGGAACTGGAGAATTGTTGAAGATGAACCAAACAAAATTTGTGAAGCCGATCGAGTGGCCATTAAAGCCAACATAGTGCACTTGATGCTTAGCAGCCCAGAGCAAATTCAGAAGCAGTTAAGTGATGCAATTAGCATTATTGGCAGAGAAGATTTTCCACAGAAATGGCCTGACTTGCTGACAGAAATGGTGAATCGCTTTCAGAGTGGAGATTTCCATGTTATTAATGGAGTCCTCCGTACAGCACATTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Woan-Ruoh Lee et al.
Molecular carcinogenesis, 55(11), 1542-1552 (2015-09-04)
The Ras/ERK (extracellular signal-regulated protein kinase) and cAMP/PKA (protein kinase A) pathways are essential for the transcriptional activities of CREB (cAMP response element binding protein) and MITF (microphthalmia-associated transcription factor) in melanogenesis and the progression of melanoma. However, the interaction
Xuebing Wang et al.
OncoTargets and therapy, 13, 1941-1951 (2020-04-11)
Recent studies have shown that noncoding RNAs (ncRNAs) play essential roles in the development of a number of cancers. Circular RNAs (circRNAs) have been shown to contribute to the progression of colorectal cancer (CRC). In this study, the expression levels
Jose M Pimiento et al.
The American journal of pathology, 186(10), 2761-2768 (2016-08-16)
Human cellular apoptosis susceptibility (chromosomal segregation 1-like, CSE1L) gene plays a role in nuclear-to-cytoplasm transport and chromosome segregation during mitosis, cellular proliferation, and apoptosis. CSE1L is involved in colon carcinogenesis. CSE1L gene expression was assessed with three data sets using

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique