Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU130941

Sigma-Aldrich

MISSION® esiRNA

targeting human FGL2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCAAAGAGGAGATCAATGTACTTCATGGTCGCCTGGAGAAGCTGAATCTTGTAAATATGAACAACATAGAAAATTATGTTGACAGCAAAGTGGCAAATCTAACATTTGTTGTCAATAGTTTGGATGGCAAATGTTCAAAGTGTCCCAGCCAAGAACAAATACAGTCACGTCCAGTTCAACATCTAATATATAAAGATTGCTCTGACTACTACGCAATAGGCAAAAGAAGCAGTGAGACCTACAGAGTTACACCTGATCCCAAAAATAGTAGCTTTGAAGTTTACTGTGACATGGAGACCATGGGGGGAGGCTGGACAGTGCTGCAGGCACGTCTCGATGGGAGCACCAACTTCACCAGAACATGGCAAGACTACAAAGCAGGCTTTGGAAACCTCAGAAGGGAATTTTGGCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ming Tang et al.
Scientific reports, 7(1), 12676-12676 (2017-10-06)
Fibrinogen-like protein 2 (FGL2) is highly expressed in various tumour tissues and plays a vital role in tumour initiation and progression. This study evaluated the clinical significance of FGL2 in patients with clear cell renal cell carcinoma (ccRCC). FGL2 expression
Yueying Wang et al.
Molecular reproduction and development, 86(4), 354-369 (2019-01-12)
Embryonic implantation involves a complex and well-coordinated interaction between the developing conceptus and maternal uterus, and the preimplantation period has a major impact on litter size in pigs. The present study aimed to investigate the vital messenger RNAs (mRNAs) and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique