Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU127401

Sigma-Aldrich

MISSION® esiRNA

targeting human BRAF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGA

Numéro d'accès Ensembl | humain

ENSG00000157764

Numéro d'accès NCBI

NM_004333

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BRAF(673) , BRAF(673)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nicholes R Candelaria et al.
PloS one, 10(12), e0145061-e0145061 (2015-12-15)
Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease
Samantha K McCarty et al.
Endocrine-related cancer, 21(6), 865-877 (2014-09-18)
Increased p21-activated kinase (PAK) signaling and expression have been identified in the invasive fronts of aggressive papillary thyroid cancers (PTCs), including those with RET/PTC, BRAFV600E, and mutant RAS expression. Functionally, thyroid cancer cell motility in vitro is dependent on group
Xin Zhang et al.
The EMBO journal, 38(15), e100871-e100871 (2019-07-16)
Reactive oxygen species (ROS) are emerging as important regulators of cancer growth and metastatic spread. However, how cells integrate redox signals to affect cancer progression is not fully understood. Mitochondria are cellular redox hubs, which are highly regulated by interactions
Yujuan Zhang et al.
Nanomedicine : nanotechnology, biology, and medicine, 14(5), 1679-1693 (2018-04-24)
Melanoma is significantly associated with mutant BRAF gene, a suitable target for siRNA-based anti-melanoma therapy. However, a tumor-specific delivery system is a major hurdle for clinical applications. Here, we developed a novel nano-carrier, FA-GNR-siBRAF for safe topical application, which consists
Lin Feng et al.
Biochemical and biophysical research communications, 524(1), 28-35 (2020-01-26)
BRAFV600E mutation is frequently observed in melanoma, and contributes to tumor malignancy. Despite inhibition of BRAF causes a profound cell growth inhibition and a strong clinical benefit in BRAFV600E melanoma, acquired drug resistance is still the major hurdle. In this
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique