Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU125021

Sigma-Aldrich

MISSION® esiRNA

targeting human GYPC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAGGAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCATCTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCAGAGCTAAAAGG

Numéro d'accès Ensembl | humain

ENSG00000136732

Numéro d'accès NCBI

NM_002101

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GYPC(2995) , GYPC(2995)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jie Liu et al.
Hepatology (Baltimore, Md.), 69(4), 1535-1548 (2018-12-07)
Endocannabinoids promote energy conservation in obesity, whereas cannabinoid-1 receptor (CB1 R) blockade reverses body weight gain and insulin resistance and increases energy expenditure. Here we investigated the molecular mechanisms of the catabolic effects of CB1 R blockade in the liver.
Weiwei Cheng et al.
Neuron, 104(5), 885-898 (2019-10-08)
Hexanucleotide GGGGCC repeat expansion in C9ORF72 is the most prevalent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). One pathogenic mechanism is the aberrant accumulation of dipeptide repeat (DPR) proteins produced by the unconventional translation of expanded RNA repeats.
Charles A Berdan et al.
Cell chemical biology, 26(7), 1027-1035 (2019-05-14)
Parthenolide, a natural product from the feverfew plant and member of the large family of sesquiterpene lactones, exerts multiple biological and therapeutic activities including anti-inflammatory and anti-cancer effects. Here, we further study the parthenolide mechanism of action using activity-based protein
Arif Yurdagul et al.
Cell metabolism, 31(3), 518-533 (2020-02-01)
Continual efferocytic clearance of apoptotic cells (ACs) by macrophages prevents necrosis and promotes injury resolution. How continual efferocytosis is promoted is not clear. Here, we show that the process is optimized by linking the metabolism of engulfed cargo from initial
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique