Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU121451

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHB3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCAACATCCTTGTCAACAGCAACCTGGTCTGCAAAGTCTCAGACTTTGGCCTCTCCCGCTTCCTGGAGGATGACCCCTCCGATCCTACCTACACCAGTTCCCTGGGCGGGAAGATCCCCATCCGCTGGACTGCCCCAGAGGCCATAGCCTATCGGAAGTTCACTTCTGCTAGTGATGTCTGGAGCTACGGAATTGTCATGTGGGAGGTCATGAGCTATGGAGAGCGACCCTACTGGGACATGAGCAACCAGGATGTCATCAATGCCGTGGAGCAGGATTACCGGCTGCCACCACCCATGGACTGTCCCACAGCACTGCACCAGCTCATGCTGGACTGCTGGGTGCGGGACCGGAACCTCAGGCCCAAATTCTCCCAGATTGTCAATACCCTGGACAAGCTCATCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guodong Zhang et al.
Cancer science, 108(3), 408-418 (2017-04-04)
microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in
Bo Gun Jang et al.
Biomolecules, 10(4) (2020-04-17)
The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) is expressed in cells at the base of intestinal crypts, acting as a cellular guide in the maintenance of intestinal crypt architecture. We aimed to investigate the expression profile of EPHB3
Seong Hye Park et al.
Theranostics, 9(8), 2235-2251 (2019-06-01)
A major problem of colorectal cancer (CRC) targeted therapies is relapse caused by drug resistance. In most cases of CRC, patients develop resistance to anticancer drugs. Cetuximab does not show many of the side effects of other anticancer drugs and
Benjamin Lin et al.
Nature communications, 6, 6619-6619 (2015-04-09)
Directed cell migration in native environments is influenced by multiple migratory cues. These cues may include simultaneously occurring attractive soluble growth factor gradients and repulsive effects arising from cell-cell contact, termed contact inhibition of locomotion (CIL). How single cells reconcile

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique