Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yusuke Kinugasa et al.
Yonsei medical journal, 53(4), 849-855 (2012-06-06)
We recently demonstrated the morphology of the anococcygeal ligament. As the anococcygeal ligament and raphe are often confused, the concept of the anococcygeal raphe needs to be re-examined from the perspective of fetal development, as well as in terms of
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl
Ji Hyun Kim et al.
Anatomy & cell biology, 49(1), 50-60 (2016-04-07)
Fetal development of the face involves a specific type of cornification in which keratinocytes provide a mass or plug to fill a cavity. The epithelial-mesenchymal interaction was likely to be different from that in the usual skin. We examined expression
Christoph Daniel et al.
PloS one, 8(12), e83846-e83846 (2014-01-01)
We recently identified Thrombospondin-2 (TSP-2) as a regulator of matrix remodelling and inflammation in experimental kidney disease by using TSP-2 null mice and successfully proved TSP-2 overexpression as a therapeutic concept in a short term glomerulonephritis model in the rat.
Shogo Hayashi et al.
Anatomy & cell biology, 46(2), 149-156 (2013-07-23)
The supinator muscle originates from the annular ligament of the radius, and the muscle fibers and ligament take a similar winding course. Likewise, the coccygeus muscle and the sacrospinous ligament are attached together, and show a similar fiber orientation. During

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique