Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU120531

Sigma-Aldrich

MISSION® esiRNA

targeting human USP22

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGACAACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTACACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACCAAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAGTTCCTGGAATACGAGTAGCCTTATCTGCAGCTGGTCAGAAAAACAAAGGCAATGCATTGGCAAGCCTCACAAAGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dongyeon Kim et al.
Journal of cellular physiology, 232(12), 3664-3676 (2017-02-06)
The proto-oncogene c-Myc has a pivotal function in growth control, differentiation, and apoptosis and is frequently affected in human cancer, including breast cancer. Ubiquitin-specific protease 22 (USP22), a member of the USP family of deubiquitinating enzymes (DUBs), mediates deubiquitination of
Gaojun Xu et al.
Experimental cell research, 362(2), 268-278 (2017-11-28)
MicroRNA-30e-5p (miR-30e-5p) is a tumor suppressor that is known to be downregulated in non-small cell lung cancer (NSCLC). However, how miR-30e-5p inhibits NSCLC tumorigenesis is not known. Ubiquitin-specific peptidase 22 (USP22) is upregulated in NSCLC and promotes tumorigenesis via a
An-Long Ji et al.
World journal of gastroenterology, 25(7), 824-836 (2019-02-28)
Intestinal ischemia reperfusion (I/R) injury is a serious but common pathophysiological process of many diseases, resulting in a high mortality rate in clinical practice. Ubiquitin-specific protease 22 (USP22) acts as regulator of cell cycle progression, proliferation, and tumor invasion. Depleted
Ying Lin et al.
Oncology letters, 20(5), 246-246 (2020-09-26)
Renal cell carcinoma (RCC) is one of the commonest urological tumors. The incidence of RCC ranks third among urological tumors, after prostate cancer and bladder tumors. However, the etiology of RCC remains unclear. Ubiquitin-specific protease 22 (USP22), a potential marker
R-Q Xin et al.
European review for medical and pharmacological sciences, 24(19), 9932-9939 (2020-10-23)
MicroRNA-329-3p (miR-329-3p) has been shown to be involved in tumor development. But its role in hepatocellular carcinoma has not been explored. Our study aims to explore the effect and mechanism of miR-329-3p on hepatocellular carcinoma development. Hepatocellular carcinoma tissues and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique