Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

Numéro d'accès Ensembl | humain

ENSG00000182718

Numéro d'accès NCBI

NM_001002858

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ANXA2(302) , ANXA2(302)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Shantae M Thornton et al.
Cells, 9(4) (2020-04-25)
Langerhans cells (LC) are the resident antigen presenting cells of the mucosal epithelium and play an essential role in initiating immune responses. LC are the only cells in the body to contain Birbeck granules (BG), which are unique cytoplasmic organelles
Yuichi Mazaki et al.
Biochemical and biophysical research communications, 511(1), 69-72 (2019-02-18)
The overexpression of endothelin (ET)-1 or ET receptors (ETRs) is related to initiation and progression of tumor. In cancer cells, ET-1 activates various signaling pathways, including mitogen-activated protein kinase, phosphatidylinositol 3-kinase, protein kinase C through ETRs, although the mechanisms by
Isah Abubakar Aliyu et al.
Viruses, 11(4) (2019-04-12)
Recent evidence has demonstrated that dengue virus requires active filopodia formation for a successful infection. However, the cellular factor involved in the interaction has not been fully elucidated. We used a combination of virus overlay protein binding assay and LC-MS/MS
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique