Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU115021

Sigma-Aldrich

MISSION® esiRNA

targeting human NF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATGGATCGGCTGTTGTCCTTAATGGTGTGTAACCATGAGAAAGTGGGACTTCAAATACGGACCAATGTTAAGGATCTGGTGGGTCTAGAATTGAGTCCTGCTCTGTATCCAATGCTATTTAACAAATTGAAGAATACCATCAGCAAGTTTTTTGACTCCCAAGGACAGGTTTTATTGACTGATACCAATACTCAATTTGTAGAACAAACCATAGCTATAATGAAGAACTTGCTAGATAATCATACTGAAGGCAGCTCTGAACATCTAGGGCAAGCTAGCATTGAAACAATGATGTTAAATCTGGTCAGGTATGTTCGTGTGCTTGGGAATATGGTCCATGCAATTCAAATAAAAACGAAACTGTGTCAATTAGTTGAAGTAATGATGGCAAGGAGAGATGACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dana Rabara et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22122-22131 (2019-10-16)
KRAS mutations occur in ∼35% of colorectal cancers and promote tumor growth by constitutively activating the mitogen-activated protein kinase (MAPK) pathway. KRAS mutations at codons 12, 13, or 61 are thought to prevent GAP protein-stimulated GTP hydrolysis and render KRAS-mutated
K Mellert et al.
Scientific reports, 8(1), 6171-6171 (2018-04-20)
In Neurofibromatosis 1 (NF1) germ line loss of function mutations result in reduction of cellular neurofibromin content (NF1+/-, NF1 haploinsufficiency). The Ras-GAP neurofibromin is a very large cytoplasmic protein (2818 AA, 319 kDa) involved in the RAS-MAPK pathway. Aside from regulation
Lionel Larribère et al.
Translational oncology, 13(12), 100858-100858 (2020-09-07)
Metastases's spreading is the main cause of mortality for advanced stage cancer patients, including melanoma. The formation of metastases is favored by enhanced migratory and invasive capacities of tumor cells. Tumor suppressor gene NF1 is a negative regulator of RAS
Ritsuko Harigai et al.
Scientific reports, 8(1), 6069-6069 (2018-04-19)
Neurofibromatosis type 1 (NF1) is caused by germline mutations in the NF1 gene and is characterized by café au lait spots and benign tumours known as neurofibromas. NF1 encodes the tumour suppressor protein neurofibromin, which negatively regulates the small GTPase
Ze-Yi Zheng et al.
Cancer cell, 37(3), 387-402 (2020-03-07)
We report that neurofibromin, a tumor suppressor and Ras-GAP (GTPase-activating protein), is also an estrogen receptor-α (ER) transcriptional co-repressor through leucine/isoleucine-rich motifs that are functionally independent of GAP activity. GAP activity, in turn, does not affect ER binding. Consequently, neurofibromin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique