Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU113211

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGGCTAAGAAGGCGATTACTGCAATCTTTGACCAGTTACTGGAGTTTGTTACTGAAGGATCACATTTTGTTGAAGCAACATATAAGAATCCGGAACTTGATCGAATAGCCACTGAAGATGATCTGGTAGAAATGCAAGGATATAAAGACAAGCTTTCCATCATTGGTGAGGTGCTATCTCGGAGACACATGAAGGTGGCATTTTTTGGCAGGACAAGCAGTGGGAAGAGCTCTGTTATCAATGCAATGTTGTGGGATAAAGTTCTCCCTAGTGGGATTGGCCATATAACCAATTGCTTCCTAAGTGTTGAAGGAACTGATGGAGATAAAGCCTATCTTATGACAGAAGGATCAGATGAAAAAAAGAGTGTGAAGACAGTTAATCAACTGGCCCATGCCCTTCACATGGACAAAGATTTGAAAGCTGGCTGTCTTGTACGTGTGTTTTGGCCAAAAGCAAAATGTGCCCTCTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Chih-Wei Chen et al.
International journal of molecular sciences, 21(14) (2020-07-28)
NME3 is a member of the nucleoside diphosphate kinase (NDPK) family that binds to the mitochondrial outer membrane to stimulate mitochondrial fusion. In this study, we showed that NME3 knockdown delayed DNA repair without reducing the cellular levels of nucleotide
Irene Bertolini et al.
Developmental cell, 55(2), 163-177 (2020-08-12)
The crosstalk between tumor cells and the adjacent normal epithelium contributes to cancer progression, but its regulators have remained elusive. Here, we show that breast cancer cells maintained in hypoxia release small extracellular vesicles (sEVs) that activate mitochondrial dynamics, stimulate

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique