Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU111751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGAACCCCAAGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCA

Numéro d'accès Ensembl | humain

ENSG00000117450

Numéro d'accès NCBI

NM_002574

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRDX1(5052) , PRDX1(5052)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
OXS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

N Cong et al.
European review for medical and pharmacological sciences, 22(7), 1922-1928 (2018-04-25)
Peroxiredoxin1 (PRDX1), a class of thiol peroxidases, is a multifunctional protein. We aimed at analyzing the effect of PRDX1 on proliferation, apoptosis, migration and invasion of colorectal cancer and to investigate the potential mechanism. Western blot and PCR were used
Jean-Louis Guéant et al.
Nature communications, 9(1), 67-67 (2018-01-06)
To date, epimutations reported in man have been somatic and erased in germlines. Here, we identify a cause of the autosomal recessive cblC class of inborn errors of vitamin B
Qing Ye et al.
Cell chemical biology, 26(3), 366-377 (2019-01-22)
Peroxiredoxin 1 (Prx1) and glutaredoxin 3 (Grx3) are two major antioxidant proteins that play a critical role in maintaining redox homeostasis for tumor progression. Here, we identify the prototypical pyranonaphthoquinone natural product frenolicin B (FB) as a selective inhibitor of
Jung Mi Lim et al.
The Journal of cell biology, 210(1), 23-33 (2015-07-08)
Proteins associated with the centrosome play key roles in mitotic progression in mammalian cells. The activity of Cdk1-opposing phosphatases at the centrosome must be inhibited during early mitosis to prevent premature dephosphorylation of Cdh1-an activator of the ubiquitin ligase anaphase-promoting
Min Zhang et al.
Oncology letters, 10(3), 1841-1847 (2015-12-02)
Peroxiredoxin 1 (Prx1) has a significant role in several malignant types of tumor. However, the role of Prx1 in oral leukoplakia (OLK) has remained to be elucidated. OLK is a common precancerous lesion of the oral mucosa that has a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique