Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU108101

Sigma-Aldrich

MISSION® esiRNA

targeting human CKS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGCTCTCGTTTCATTTTCTGCAGCGCGCCAGCAGGATGGCCCACAAGCAGATCTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGGCATGTTATGTTACCCAGAGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAAGAGGAGTGGAGGAGACTTGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCATGAGCCAGAACCACATATTCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGAAGTTTATCTGGGGATCGTCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAGAAATGTACAAATCTTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGAGCTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jun Li et al.
Cancer communications (London, England), 38(1), 13-13 (2018-05-17)
Pancreatic duct adenocarcinoma (PDAC) remains a major health problem because conventional cancer treatments are relatively ineffective against it. Microarray studies have linked many genes to pancreatic cancer, but the available data have not been extensively mined for potential insights into
Yupeng Deng et al.
Oncology letters, 18(3), 2845-2852 (2019-08-28)
Cyclin-dependent kinase subunit (CKS) 2 is a member of the CKS family, which plays an important role in the regulation of meiosis and mitosis. Overexpression of CKS2 has been reported in several types of tumors. However, few studies have investigated
Min-Hao Yu et al.
American journal of cancer research, 5(9), 2708-2718 (2015-11-27)
Cyclin-dependent kinases regulatory subunit 2 (CKS2) is a cyclin-dependent kinase-interacting protein, which is essential for cell cycle regulation. Elevated expression of CKS2 has been demonstrated in multiple types of human malignancies. However, the clinical significance, oncogenic functions and related mechanisms

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique