Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU107851

Sigma-Aldrich

MISSION® esiRNA

targeting human SSB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCTCCAAGCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGTAAAAAACAGATCTGTTTATATTAAAGGCTTCCCAACTGATGCAACTCTTGATGACATAAAAGAATGGTTAGAAGATAAAGGTCAAGTACTAAATATTCAGATGAGAAGAACATTGCATAAAGCATTTAAGGGATCAATTTTTGTTGTGTTTGATAGCATTGAATCTGCTAAGAAATTTGTAGAGACCCCTGGCCAGAAGTACAAAGAAACAGACCTGCTAATACTTTTCAAGGACGATTACTTTGCCAAAAAAAATGAAGAAAGAAAACAAAATAAAGTGGAAGCTAAATTAAGAGCTAAACAGGAGCAAGAAGCAAAACAAAAGTTAGAAGAAGATGCTGAAATGAAATCTCTAGAAGAAAAGATTGGATGCTTGCTGAAATTTTCGG

Numéro d'accès Ensembl | humain

ENSG00000138385

Numéro d'accès NCBI

NM_003142

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SSB(6741) , SSB(6741)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Elsa Patricia Rondon et al.
International journal of nanomedicine, 15, 6183-6200 (2020-09-15)
Diethylaminoethyl-chitosan (DEAE-CH) is a derivative with excellent potential as a delivery vector for gene therapy applications. The aim of this study is to evaluate its toxicological profile for potential future clinical applications. An endotoxin-free chitosan (CH) modified with DEAE, folic
Radu Mihaila et al.
Molecular therapy. Nucleic acids, 7, 246-255 (2017-06-19)
Lipid nanoparticles (LNPs) have been used to successfully deliver small interfering RNAs (siRNAs) to target cells in both preclinical and clinical studies and currently are the leading systems for in vivo delivery. Here, we propose the use of an ordinary differential
Adam J Pollak et al.
Nucleic acid therapeutics, 30(5), 312-324 (2020-06-27)
In this study, we demonstrate that 5S ribosomal RNA (rRNA), a highly structured and protein-bound RNA, is quite difficult to reduce with antisense oligonucleotides (ASOs). However, we found a single accessible site that was targetable with a high-affinity complementary ASO.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique