Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU106111

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT17

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chun-Ying Xiao et al.
Chinese medical journal, 133(24), 2910-2918 (2020-11-26)
Psoriasis is a common chronic inflammatory skin disease with 2% to 3% prevalence worldwide and a heavy social-psychological burden for patients and their families. As the exact pathogenesis of psoriasis is still unknown, the current treatment is far from satisfactory.
Daisuke Ujiie et al.
Carcinogenesis, 41(5), 591-599 (2019-11-23)
Adjuvant chemotherapy is considered for patients with stage II colorectal cancer (CRC) characterized by poor prognostic clinicopathological features; however, current stratification algorithms remain inadequate for identifying high-risk patients. To develop prognostic assays, we conducted a step-wise screening and validation strategy
Mihaela Chivu-Economescu et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(6), 948-959 (2017-03-17)
Keratin 17 (KRT17) was shown to be an important molecular marker for predicting the carcinogenesis, progression, and prognosis of various cancer types. Our previous studies identified KRT17 as a possible biomarker for gastric cancer by gene microarray, with an elevated
Hui Liu et al.
Gene, 563(1), 35-40 (2015-03-10)
Hereditary protein C deficiency (PCD) is an autosomal inherited disorder associated with high risk for venous thromboembolism (VTE). This study aimed to explore the functional consequences of two missense mutations, p.Asp297His and p.Val420Ile, responsible for type I/II PCD and recurrent
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique