Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU100561

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC7A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCACCCAGCCTAGAATCTTGTATAATATGTAATTGTAGGGAAACTGCTCTCATAGGAAAGTTTTCTGCTTTTTAAATACAAAAATACATAAAAATACATAAAATCTGATGATGAATATAAAAAAGTAACCAACCTCATTGGAACAAGTATTAACATTTTGGAATATGTTTTATTAGTTTTGTGATGTACTGTTTTACAATTTTTACCATTTTTTTCAGTAATTACTGTAAAATGGTATTATTGGAATGAAACTATATTTCCTCATGTGCTGATTTGTCTTATTTTTTTCATACTTTCCCACTGGTGC

Numéro d'accès Ensembl | humain

ENSG00000172243

Numéro d'accès NCBI

NM_022570

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLEC7A(64581) , CLEC7A(64581)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nobuaki Fujiwara et al.
Cancer gene therapy, 26(1-2), 32-40 (2018-07-05)
Antisense oligonucleotides (AS-ODNs) hybridize with specific mRNAs, resulting in interference with the splicing mechanism or the regulation of protein translation. We previously demonstrated that the β-glucan schizophyllan (SPG) can form a complex with AS-ODNs with attached dA40 (AS-ODNs/SPG), and this
Kelan Yuan et al.
International immunopharmacology, 52, 168-175 (2017-09-20)
To investigate the role of phosphorylated JNK in Dectin-1-induced IL-1β production and the role of Dectin-1 in apoptosis in mouse Aspergillus fumigatus (A. fumigatus) keratitis. Mice corneas were pretreated with Dectin-1 siRNA or SP600125 (the inhibitor of JNK) before A.
Cheng-Ye Che et al.
International journal of ophthalmology, 11(6), 905-909 (2018-07-07)
To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of
Esther Weiss et al.
Frontiers in cellular and infection microbiology, 8, 288-288 (2018-09-05)
Invasive aspergillosis (IA) is an infectious disease caused by the fungal pathogen Aspergillus fumigatus that mainly affects immunocompromised hosts. To investigate immune cell cross-talk during infection with A. fumigatus, we co-cultured natural killer (NK) cells and dendritic cells (DC) after
Xia Hua et al.
PloS one, 10(6), e0128039-e0128039 (2015-06-04)
Fungal infections of the cornea can be sight-threatening and have a worse prognosis than other types of microbial corneal infections. Peptidoglycan recognition proteins (PGLYRP), which are expressed on the ocular surface, play an important role in the immune response against
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique