Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU099041

Sigma-Aldrich

MISSION® esiRNA

targeting human CBS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Amanda R Jensen et al.
Shock (Augusta, Ga.), 53(6), 737-743 (2019-07-28)
Hydrogen sulfide (H2S) has many beneficial biological properties, including the ability to promote vasodilation. It has been shown to be released from stem cells and increased by hypoxia. Therefore, H2S may be an important paracrine factor in stem cell-mediated intestinal
Mingqi Wang et al.
Biochemical pharmacology, 172, 113775-113775 (2019-12-25)
Hydrogen sulfide (H2S) has been frequently implicated in tumor progression. However, the exact regulation mechanism of H2S in human non-small cell lung cancer (NSCLC) has not been fully elucidated. Here, analysis of NSCLC biopsies and adjacent non-tumor tissues revealed selectively
Xiangning Yuan et al.
Kidney & blood pressure research, 42(3), 428-443 (2017-07-28)
Renal tubulointerstitial fibrosis (TIF) is the common pathway of progressive chronic kidney disease. Inflammation has been widely accepted as the major driving force of TIF. Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway. CBS is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique