Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU098321

Sigma-Aldrich

MISSION® esiRNA

targeting human SYF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCACATTTTTGTGCTTGGATATAAGATGTATTTCTTGTAGTGAAGTTGTTTTGTAATCTACTTTGTATACATTCTAATTATATTATTTTTCTATGTATTTTAAATGTATATGGCTGTTTAATCTTTGAAGCATTTTGGGCTTAAGATTGCCAGCAGCACACATCAGATGCAGTCATTGTTGCTATCAGTGTGGAATTTGATAGAGTCTAGACTCGGGCCACTTGGAGTTGTGTACTCCAAAGCTAAGGACAGTGATGAGGAAGATGGCA

Numéro d'accès Ensembl | humain

ENSG00000117614

Numéro d'accès NCBI

NM_015484

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SYF2(25949) , SYF2(25949)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feng Shi et al.
Oncotarget, 8(51), 88453-88463 (2017-11-29)
SYF2, a known cell cycle regulator, is reported to be involved in cell cycle arrest by interacting with cyclin-D-type binding protein 1. In the present study, we investigated the role of SYF2 in human breast cancer (BC) progression. SYF2 was
Youmao Tao et al.
Archives of biochemistry and biophysics, 688, 108406-108406 (2020-05-18)
Increasing evidence indicates that aberrantly expressed microRNAs play a role in tumorigenesis and progression of gastric cancer. Recently, a novel cancer-related microRNA, miR-621, was found to be involved in cancer pathogenesis. However, the precise molecular mechanisms underlying the oncogenic activity
Chia-Hsin Chen et al.
PloS one, 7(3), e33538-e33538 (2012-03-27)
Human p29 is a putative component of spliceosomes, but its role in pre-mRNA is elusive. By siRNA knockdown and stable overexpression, we demonstrated that human p29 is involved in DNA damage response and Fanconi anemia pathway in cultured cells. In

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique