Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU094691

Sigma-Aldrich

MISSION® esiRNA

targeting human CD44

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTAAAGGGATTCCCATCATTGGAATCTTATCACCAGATAGGCAAGTTTATGACCAAACAAGAGAGTACTGGCTTTATCCTCTAACCTCATATTTTCTCCCACTTGGCAAGTCCTTTGTGGCATTTATTCATCAGTCAGGGTGTCCGATTGGTCCTAGAACTTCCAAAGGCTGCTTGTCATAGAAGCCATTGCATCTATAAAGCAACGGCTCCTGTTAAATGGTATCTCCTTTCTGAGGCTCCTACTAAAAGTCATTTGTTACCTAAACTTATGTGCTTAACAGGCAATGCTTCTCAGACCACAAAGCAGAAAGAAGAAGAAAAGCTCCTGACTAAATCAGGGCTGGGCTT

Numéro d'accès Ensembl | humain

ENSG00000026508

Numéro d'accès NCBI

NM_001001391

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CD44(960) , CD44(960)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zenghui Fang et al.
Experimental cell research, 382(1), 111462-111462 (2019-06-14)
Scaffolding adaptor Gab2 is overexpressed in a subset of high-grade ovarian cancer. Our published work shows that Gab2 via PI3K enhances migratory behaviors and epithelial to mesenchymal transition (EMT) features of ovarian cancer cells in vitro. However, it is still
Yunhee Cho et al.
Oncotarget, 6(11), 8709-8721 (2015-04-25)
CD44 plays a role in the progression of tumors and is expressed in cancer stem cells (CSCs). However, the mechanisms underlying the crosstalk of CD44 with stemness genes in CSC maintenance remains unclear. In this study, we demonstrated how the
Lu-Lu Wang et al.
Biomaterials, 141, 13-28 (2017-07-01)
Small active RNA (saRNA)-induced gene activation (RNAa) is a novel strategy to treat cancer. Our previous work proved that the p21-saRNA-322 successfully hindered colorectal cancer growth by activating p21 gene. However, the barrier for successful saRNA therapy is lack of
Wenzhe Li et al.
Scientific reports, 7(1), 13856-13856 (2017-10-25)
CD44/CD24 and ALDH1 are widely used cancer stem cell (CSC) markers in breast cancer. However, their expression is not always consistent even in the same subtype of breast cancer. Systematic comparison of their functions is still lacking. We investigated the
Shan Hwu Chew et al.
Free radical biology & medicine, 106, 91-99 (2017-02-12)
CD44 exists as a standard (CD44s) isoform and different variant isoforms (CD44v) due to alternative splicing. While the complex nature of these different isoforms has not been fully elucidated, CD44v expression has been shown to exert oncogenic effects by promoting
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique