Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU093271

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCACAGACAGCACTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGC

Numéro d'accès Ensembl | humain

ENSG00000124333

Numéro d'accès NCBI

NM_005638

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VAMP7(6845) , VAMP7(6845)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Increased gene copy number of VAMP7 disrupts human male urogenital development through altered estrogen action.
Tannour-Louet M
Nature Medicine, 20, 715-715 (2014)
hVps41 and VAMP7 function in direct TGN to late endosome transport of lysosomal membrane proteins.
Pols MS
Nature Communications, 4, 1361-1361 (2013)
Laure-Anne Ligeon et al.
Autophagy, 10(9), 1588-1602 (2014-07-22)
Yersinia pseudotuberculosis can replicate inside macrophages by hijacking autophagy and blocking autophagosome acidification. In bone marrow-derived macrophages, the bacteria are mainly observed inside double-membrane vacuoles positive for LC3, a hallmark of autophagy. Here, we address the question of the membrane
Secil Koseoglu et al.
Blood, 126(5), 651-660 (2015-05-23)
Platelet activation results in profound morphologic changes accompanied by release of granule contents. Recent evidence indicates that fusion of granules with the plasma membrane during activation provides auxiliary membrane to cover growing actin structures. Yet little is known about how
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique