Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU093191

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK1A1, CTB-89H12.4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGTGGAGAAATTGTGCATATGCCAATTTTTTGTTAAAACCTTTTGTTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTTAAATGCTCACAATTGTGCATTCTTAGGGTTTTTCCATCCCTGGGGTTTGCAAGTTGTTCACTTAAAACATTCTTAAAATGGTTGGCTTCTTGTCTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATATGAAAGACTCTGCCTGCTTAATTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAACTTAGTGACTACTAGATTATCCTTAGGACTCTGCATTAACTCTATAATGTTCTTGGTATTAAAAAAAAAGCATATTTGTCACAGAAATTT

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Luke J Fulcher et al.
EMBO reports, 20(9), e47495-e47495 (2019-07-25)
The concerted action of many protein kinases helps orchestrate the error-free progression through mitosis of mammalian cells. The roles and regulation of some prominent mitotic kinases, such as cyclin-dependent kinases, are well established. However, these and other known mitotic kinases
Xia Liu et al.
Oncogene, 39(1), 176-186 (2019-08-30)
Somatic missense mutations of the CSNK1A1 gene encoding casein kinase 1 alpha (CK1α) occur in a subset of myelodysplastic syndrome (MDS) with del(5q) karyotype. The chromosomal deletion causes CSNK1A1 haplo-insufficiency. CK1α mutations have also been observed in a variety of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique