Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU091361

Sigma-Aldrich

MISSION® esiRNA

targeting human MRE11

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA

Numéro d'accès Ensembl | humain

ENSG00000020922

Numéro d'accès NCBI

NM_005591

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MRE11(4361) , MRE11A(4361)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Interaction of MRE11 and Clinicopathologic Characteristics in Recurrence of Breast Cancer: Individual and Cumulated Receiver Operating Characteristic Analyses.
Yang CH
BioMed Research International, 2017, 2563910-2563910 (2017)
Rad51 recombinase prevents Mre11 nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation.
Vallerga MB
Proceedings of the National Academy of Sciences of the USA, 112, E6624-E6624 (2015)
M Petroni et al.
Cell death and differentiation, 23(2), 197-206 (2015-06-13)
The MRE11/RAD50/NBS1 (MRN) complex is a major sensor of DNA double strand breaks, whose role in controlling faithful DNA replication and preventing replication stress is also emerging. Inactivation of the MRN complex invariably leads to developmental and/or degenerative neuronal defects
A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique