Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yaw Asare et al.
Circulation research, 127(6), 811-823 (2020-06-18)
Arterial inflammation manifested as atherosclerosis is the leading cause of mortality worldwide. Genome-wide association studies have identified a prominent role of HDAC (histone deacetylase)-9 in atherosclerosis and its clinical complications including stroke and myocardial infarction. To determine the mechanisms linking
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Zhongxing Liang et al.
Cancer chemotherapy and pharmacology, 85(2), 413-423 (2020-01-08)
Although histone deacetylase (HDAC) inhibitors have been shown to effectively induce the inhibition of proliferation and migration in breast cancer, the mechanism of HDAC9's contribution to chemoresistance remains poorly understood. The aim of this study was to investigate the role
Yuxin Li et al.
Cell death & disease, 11(9), 753-753 (2020-09-17)
HDAC inhibitors are efficacious for treating lymphoma, but display limited efficacy in treating solid tumors. Here, we investigated the relationship between HDAC inhibitor resistance and the tumor immune environment in colorectal cancer. Our data indicated that among the investigated immune
Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique