Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU087831

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM29

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCATGGATGCTCTGGATGAGAGAGCCAAGGTGCTGCATGAGGACAAGCAGACCCGGGAGCAGCTGCATAGCATCAGCGACTCTGTGTTGTTTCTGCAGGAATTTGGTGCATTGATGAGCAATTACTCTCTCCCCCCACCCCTGCCCACCTATCATGTCCTGCTGGAGGGGGAGGGCCTGGGACAGTCACTAGGCAACTTCAAGGACGACCTGCTCAATGTATGCATGCGCCACGTTGAGAAGATGTGCAAGGCGGACCTGAGCCGTAACTTCATTGAGAGGAACCACATGGAGAACGGTGGTGACCATCGCTATGTGAACAACTACACGAACAGCTTCGGGGGTGAGTGGAGTGCACCGGACACCATGAAGAGATACTCCATGTACCTGACACCCAAAGGTGGGGTCCGGACATCATACCAGCCCTCGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jing Han et al.
Aging, 13(4), 5034-5054 (2021-01-27)
Targeted molecular therapy is the most effective treatment for cancer. An effective therapeutic target for colorectal cancer (CRC) is urgently needed. However, the mechanisms of CRC remain poorly understood, which has hampered research and development of CRC-targeted therapy. TRIM29 is
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Yasushi Masuda et al.
Nature communications, 6, 7299-7299 (2015-06-23)
Although DNA double-strand break (DSB) repair is mediated by numerous proteins accumulated at DSB sites, how DNA repair proteins are assembled into damaged chromatin has not been fully elucidated. Here we show that a member of the tripartite motif protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique