Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU085901

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAAAGAGCCGAGTGGACTAAGATTCAACAAACTATTTTTGAATGAAGATGATAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAATAATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATTGAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTGGTGAAAGAGTACTGAGCCCTGAAGCAGTTC

Numéro d'accès Ensembl | humain

ENSG00000115419

Numéro d'accès NCBI

NM_014905

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GLS(2744) , GLS(2744)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Denis A Mogilenko et al.
Cell, 177(5), 1201-1216 (2019-04-30)
Innate immune responses are intricately linked with intracellular metabolism of myeloid cells. Toll-like receptor (TLR) stimulation shifts intracellular metabolism toward glycolysis, while anti-inflammatory signals depend on enhanced mitochondrial respiration. How exogenous metabolic signals affect the immune response is unknown. We
Jae-Seon Lee et al.
Biochemical and biophysical research communications, 477(3), 374-382 (2016-06-25)
We found that non-small cell lung cancer (NSCLC) is remarkably sensitive to the regulation of glutamine supply by testing the metabolic dependency of 11 cancer cell lines against regulation of glycolysis, autophagy, fatty acid synthesis, and glutamine supply. Glutamine is
Lisha Xiang et al.
Cell death & disease, 10(2), 40-40 (2019-01-25)
Cancer cells re-program their metabolic machinery to meet the requirements of malignant transformation and progression. Glutaminase 1 (GLS1) was traditionally known as a mitochondrial enzyme that hydrolyzes glutamine into glutamate and fuels rapid proliferation of cancer cells. However, emerging evidence
Xuan Qu et al.
Biochemical and biophysical research communications, 504(2), 415-421 (2018-08-15)
Oncogenic c-Myc-induced metabolic reprogramming triggers cellular dependency on exogenous glucose and glutamine. Understanding how nutrients are used may provide new target for therapeutic intervention. We previously provided an alternate route to c-Myc-driven glucose metabolism via the repression of thioredoxin-interacting protein
Yuta Mizuno et al.
Oncology letters, 19(4), 2934-2942 (2020-03-29)
The high expression of metabolic enzymes, including glutaminase (GA) and lactate dehydrogenase A (LDHA), which contribute to bioenergetics and biosynthesis of mammalian cells, has been identified in a variety of cancer types. The current study indicated intratumoral heterogeneity with respect
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique