Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU085731

Sigma-Aldrich

MISSION® esiRNA

targeting human MKNK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTGGCCTTCTCCCTAGACCAGCCCGACCACGGAGACTCTGACTTTGGCCTGCAGTGCTCAGCCCGCCCTGACATGCCCGCCAGCCAGCCCATTGACATCCCGGACGCCAAGAAGAGGGGCAAGAAGAAGAAGCGCGGCCGGGCCACCGACAGCTTCTCGGGCAGGTTTGAAGACGTCTACCAGCTGCAGGAAGATGTGCTGGGGGAGGGCGCTCATGCCCGAGTGCAGACCTGCATCAACCTGATCACCAGCCAGGAGTACGCCGTCAAGATCATTGAGAAGCAGCCAGGCCACATTCGGAGCAGGGTTTTCAGGGAGGTGGAGATGCTGTACCAGTGCCAGGGACACAGGAACGTCCTAGAGCTGATTGAGTTCTTCGAGGAGGAGGACCGCTTCTAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jonathan B Bell et al.
Molecular cancer research : MCR, 16(1), 32-46 (2017-10-19)
Mesenchymal (MES) and proneural (PN) are two distinct glioma stem cell (GSC) populations that drive therapeutic resistance in glioblastoma (GBM). We screened a panel of 650 small molecules against patient-derived GBM cells to discover compounds targeting specific GBM subtypes. Arsenic
Zhihua Guo et al.
Scientific reports, 7(1), 10612-10612 (2017-09-08)
We hypothesized that MAP kinase-interacting serine/threonine kinase 2 (MNK2) may contribute to non-small cell lung cancer (NSCLC) development, and serve as a new therapeutic target. Immunohistochemical staining evaluated the correlation between MNK2 expression and clinicopathological features in 367 NSCLC cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique