Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU084471

Sigma-Aldrich

MISSION® esiRNA

targeting human WASF3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCACATGAGGAAATAGGCTGTCACTATCACATTGTCCTGAAAACAGCATCTGCTTTCCTCTTGGCCATGAGAGTATTTAGTGCAGTTTGGGTTTACTCTTACTGATCAATATAACTCTGCAGACTTGCTGTGTGTTTGTGAAGCTGCCTGGTGTTAGGTCTCTGCAAGACTAATGACTATGTCAGAGTGATGTCTTCCAACCAGTAAGTGATATTGTTTCACCGCTTTGGTTTTTCCTTTTGTTTTTTTAAAGGATGTGTTTCTGAATAAGTTGGTTTTAGAGGGAAAGGTTCAACAAACAGGGAGAATCCAGTGTTTCTGCTTTCAGTTTCTTGGCTTGGTAGCCTCTGAGTGAATCTGATGCTCTGCTGAATAATTTCATTACCTCTGCACATGCCTGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jin Lu et al.
Oncotarget, 8(25), 41189-41201 (2017-05-06)
Wiskott-Aldrich syndrome verprolin-homologous (WAVE) 3, a member of the WASP/WAVE family of proteins, plays a critical role in cell motility and acts as an oncogene in some human cancers, but no sufficient information available to illustrate its involvement in ovarian
Shaobin Huang et al.
International journal of oncology, 53(2), 672-684 (2018-05-31)
Alterations in Wiskott-Aldrich syndrome protein family verprolin-homologous protein 3 (WAVE3) expression play various roles in certain types of cancer. However, the roles of WAVE3 expression in pancreatic cancer remain unknown. The present retrospective study demonstrated that WAVE3 expression was higher in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique