Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU081321

Sigma-Aldrich

MISSION® esiRNA

targeting human BDNF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC

Numéro d'accès Ensembl | humain

ENSG00000176697

Numéro d'accès NCBI

NM_170731

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BDNF(627) , BDNF(627)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
XVU
QCS
EZR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

L Gao et al.
Neoplasma, 65(1), 89-96 (2018-01-13)
Recent studies have confirmed the existence of BDNF and tropomyosin-related kinase B (TrkB) in normal and cancerous urothelium. However, the corresponding mechanisms and upstream signal pathways of BDNF/TrkB have not been fully discovered. This study aimed to investigate the effects
E Bouvier et al.
Molecular psychiatry, 22(12), 1701-1713 (2016-09-21)
Stressful life events produce a state of vulnerability to depression in some individuals. The mechanisms that contribute to vulnerability to depression remain poorly understood. A rat model of intense stress (social defeat (SD), first hit) produced vulnerability to depression in
Yu-Pu Liu et al.
Frontiers in neuroscience, 14, 525144-525144 (2020-11-03)
Growing evidence indicates that electroacupuncture (EA) has a definite effect on the treatment of peripheral nerve injury (PNI), but its mechanism is not completely clear. MicroRNAs (miRNAs) are involved in the regulation of a variety of biological processes, and EA
Chun-Yan Sun et al.
Oncology reports, 37(5), 2751-2760 (2017-04-14)
Brain-derived neurotrophic factor (BDNF) is expressed in a number of neural and non-neuronal tumors. The present study investigated the effect of endogenous BDNF on the biological behavior of cervix cancer cells using small interfering RNA (siRNA). HeLa, a cervix cancer
Abdelrahman Y Fouda et al.
Molecular neurobiology, 54(1), 661-670 (2016-01-14)
Angiotensin type 1 receptor blockers (ARBs) have been shown to be neuroprotective and neurorestorative in experimental stroke. The mechanisms proposed include anti-inflammatory, antiapoptotic effects, as well as stimulation of endogenous trophic factors leading to angiogenesis and neuroplasticity. We aimed to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique