Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU078761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCCTGGAGTCCTACATCTCACAGCAGAAGACGGGCGTGGGAGGGACTGGAATTGACATCCCTGTCCTGCTCCTCCTGATTGATGGTGATGAGAAGATGTTGACGCGAATAGAGAACGCCACCCAGGCTCAGCTCCCATGTCTCCTCGTGGCTGGCTCAGGGGGAGCTGCGGACTGCCTGGCGGAGACCCTGGAAGACACTCTGGCCCCAGGGAGTGGGGGAGCCAGGCAAGGCGAAGCCCGAGATCGAATCAGGCGTTTCTTTCCCAAAGGGGACCTTGAGGTCCTGCAGGCCCAGGTGGAGAGGATTATGACCCGGAAGGAGCTCCTGACAGTCTATTCTTCTGAGGATGGGTCTGAGGAATTCGAGACCATAGTTTTGAAGGCCCTTGTGAAGGCCTGTGGGAGCTCGGAGGCCTCAGCCTACCTGGATGAGCTGCGTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xi Hong et al.
American journal of physiology. Cell physiology, 316(4), C463-C480 (2018-12-20)
Prostate cancer (PCa) remains one of the leading causes of cancer-related deaths among males. The aim of the current study was to investigate the ability of microRNA-150 (miR-150) targeting transient receptor potential melastatin 4 (TRPM4) to mediate epithelial-mesenchymal transition (EMT)
Fujue Wang et al.
Cellular signalling, 72, 109643-109643 (2020-04-23)
Transient Receptor Potential Melastatin Subfamily Member 4 (TRPM4) has been demonstrated to be aberrantly expressed in several cancers but seldom reported in acute leukemia. Based on database mining and validated experiments, our present data show that TRPM4 is selectively overexpressed
Elías Leiva-Salcedo et al.
Channels (Austin, Tex.), 11(6), 624-635 (2017-09-07)
Cerebral ischemia-reperfusion injury triggers a deleterious process ending in neuronal death. This process has two components, a glutamate-dependent and a glutamate-independent mechanism. In the glutamate-independent mechanism, neurons undergo a slow depolarization eventually leading to neuronal death. However, little is known
Chun-Xiao Yu et al.
Toxicology letters, 312, 98-108 (2019-05-06)
To investigate the effect of Arsenic Trioxide (ATO) on endothelial cells injury and explore the role of transient receptor potential melastatin 4 channel (TRPM4) in ATO-induced endothelial injury. qRT-PCR was used to examine the mRNA expression of TRPM4 in human
Christian Holzmann et al.
Oncotarget, 6(39), 41783-41793 (2015-10-27)
Impaired Ca2+ signaling in prostate cancer contributes to several cancer hallmarks, such as enhanced proliferation and migration and a decreased ability to induce apoptosis. Na+ influx via transient receptor potential melastatin 4 channel (TRPM4) can reduce store-operated Ca2+ entry (SOCE)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique