Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU078241

Sigma-Aldrich

MISSION® esiRNA

targeting human TJP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATTTGAACGCAAGTTTGAAAGTCCTAAATTCAATCACAATCTTCTGCCAAGTGAAACTGCACATAAACCTGACTTGTCTTCAAAAACTCCCACTTCTCCAAAAACTCTTGTGAAATCGCACAGTTTGGCACAGCCTCCTGAGTTTGACAGTGGAGTTGAAACTTTCTCTATCCATGCAGAGAAGCCTAAATATCAAATAAATAATATCAGCACAGTGCCTAAAGCTATTCCTGTGAGTCCTTCAGCTGTGGAAGAGGATGAAGATGAAGATGGTCATACTGTGGTGGCCACAGCCCGAGGCATATTTAACAGCAATGGGGGCGTGCTGAGTTCCATAGAAACTGGTGTTAGTATAATTATCCCTCAAGGAGCCATTCCCGAAGGAGTTGAGCAGGAAATCTATTTCAAGGTCTGCCGGGACAACAGCATCCTTCCACCTT

Numéro d'accès Ensembl | humain

ENSG00000104067

Numéro d'accès NCBI

NM_003257

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TJP1(7082) , TJP1(7082)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mahnaz Ramezanpour et al.
Mediators of inflammation, 2016, 9798206-9798206 (2016-02-24)
Cytokine mediated changes in paracellular permeability contribute to a multitude of pathological conditions including chronic rhinosinusitis (CRS). The purpose of this study was to investigate the effect of interferons and of Th1, Th2, and Th17 cytokines on respiratory epithelium barrier
Alan S Fanning et al.
Molecular biology of the cell, 23(4), 577-590 (2011-12-23)
The structure and function of both adherens (AJ) and tight (TJ) junctions are dependent on the cortical actin cytoskeleton. The zonula occludens (ZO)-1 and -2 proteins have context-dependent interactions with both junction types and bind directly to F-actin and other
Robert L Gendron et al.
Molecular vision, 17, 2596-2604 (2011-10-26)
The rainbow smelt (Osmerus mordax), is a teleost fish, which avoids freezing by becoming virtually isosmotic with seawater. The effects that such massive changes in osmolarity have on both its visual system and its highly evolved and specialized circulation are
Madhavi P Maddugoda et al.
The Journal of cell biology, 178(3), 529-540 (2007-08-01)
Cooperation between cadherins and the actin cytoskeleton controls many aspects of epithelial biogenesis. We report here that myosin VI critically regulates the morphogenesis of epithelial cell-cell contacts. As epithelial monolayers mature in culture, discontinuous cell-cell contacts are initially replaced by
N T K Vo et al.
Journal of fish diseases, 39(2), 175-188 (2015-02-04)
A cell line, WE-cfin11e, with an epithelial-like morphology was developed from a caudal fin of walleye, Sander vitreus (Mitchill), characterized as distinct from the established walleye caudal fin fibroblast-like cell line, WE-cfin11f, and compared with WE-cfin11f for susceptibility to VHSV
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique