Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU077821

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB20

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

An-Jing Ren et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13862-13876 (2020-08-28)
The zinc-finger protein ZBTB20 regulates development and metabolism in multiple systems, and is essential for postnatal survival in mice. However, its potential role in the cardiovascular system remains undefined. Here, we demonstrate that ZBTB20 is critically involved in the regulation
Liuyang Wang et al.
Cell host & microbe, 24(2), 308-323 (2018-08-10)
Pathogens have been a strong driving force for natural selection. Therefore, understanding how human genetic differences impact infection-related cellular traits can mechanistically link genetic variation to disease susceptibility. Here we report the Hi-HOST Phenome Project (H2P2): a catalog of cellular
Ji Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(5), 2074-2083 (2018-08-14)
To determine the cellular functions and clinical significance of micro-758-5p (miR-758-5p) in glioblastoma (GBM) by targeting zinc finger and BTB domain-containing protein 20 (ZBTB20). Fifty-five paired GBM tissues and adjacent normal tissues, GBM cell lines (U118, LN-299, H4, A172, U87-MG

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique