Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU077111

Sigma-Aldrich

MISSION® esiRNA

targeting human GAB1 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGACATTCCTCCAACACCTGGTAATACTTATCAGATTCCACGAACATTTCCAGAAGGAACCTTGGGACAGACATCAAAGCTAGACACTATTCCAGATATTCCTCCACCTCGGCCACCGAAACCACATCCAGCTCATGACCGATCTCCTGTGGAAACGTGTAGTATCCCACGCACCGCCTCAGACACTGACAGTAGTTACTGTATCCCTACAGCAGGGATGTCGCCTTCACGTAGTAATACCATTTCCACTGTGGATTTAAACAAATTGCGAAAAGATGCTAGTTCTCAAGACTGCTATGATATTCCACGAGCATTTCCAAGTGATAGATCTAGTTCACTTGAAGGCTTCCATAACCACTTTAAAGTCAAAAATGTGTTGACAGTGGGAAGTGTTTCAAGTGAAGAACTGGATGAAAATTACGTCCCAATGAATCCCAATTCACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Meaghan H Hancock et al.
mSphere, 5(4) (2020-08-08)
Regulation of epidermal growth factor (EGF) receptor (EGFR) signaling is critical for the replication of human cytomegalovirus (HCMV) as well as latency and reactivation in CD34+ hematopoietic progenitor cells. HCMV microRNAs (miRNAs) provide a means to modulate the signaling activated
Chi-Hao Chang et al.
Oncotarget, 6(3), 1478-1489 (2015-01-19)
Urothelial carcinoma is the most common type of malignancy in long-term dialysis patients and kidney transplant recipients in Taiwan. mTORCs (mammalian target of rapamycin complexes) and EGF are important in urothelial carcinoma. To identify the regulation of mTORCs upon EGF

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique