Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU076601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGACCTGAATGAGGAGGAAACCATTCTCATCATCCGGCGTCTCCACAAAGTGCTGCGGCCCTTCTTGCTCCGACGACTCAAGAAGGAAGTCGAGGCCCAGTTGCCCGAAAAGGTGGAGTACGTCATCAAGTGCGACATGTCTGCGCTGCAGCGAGTGCTCTACCGCCACATGCAGGCCAAGGGCGTGCTGCTGACTGATGGCTCCGAGAAGGACAAGAAGGGCAAAGGCGGCACCAAGACCCTGATGAACACCATCATGCAGCTGCGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATCGAGGAGTCCTTTTCCGAGCACTTGGGGTTCACTGGCGGCATTGTCCAAGGGCTGGACCTGTACCGAGCCTCGGGTAAATTTGAGCTTCTTGATAGAATTCTTCCCAAACTCCGAGCAACCAACCACAAAGTGCTGCTGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wentao Sun et al.
European journal of pharmacology, 875, 173038-173038 (2020-02-28)
High glucose (HG)-induced oxidative damage of retinal ganglion cells (RGCs) contributes to the pathogenesis of diabetic retinopathy, a severe complication of diabetes mellitus. Brahma-related gene 1 (Brg1) has currently emerged as a cytoprotective protein that alleviates oxidative damage induced by
Shujie Song et al.
Molecular cancer research : MCR, 18(12), 1777-1788 (2020-08-29)
The NF-E2-related factor 2 (referred to as NRF2) transcription factor binds antioxidant responsive elements within the promoters of cytoprotective genes to induce their expression. Next-generation sequencing studies in lung cancer have shown a significant number of activating mutations within the
Tatiana Souslova et al.
Molecular neurobiology, 54(10), 8263-8277 (2016-12-04)
Five-prime repressor element under dual repression binding protein-1 (Freud-1)/CC2D1A is genetically linked to intellectual disability and implicated in neuronal development. Freud-1 represses the serotonin-1A (5-HT1A) receptor gene HTR1A by histone deacetylase (HDAC)-dependent or HDAC-independent mechanisms in 5-HT1A-negative (e.g., HEK-293) or
Xiaoping Liu et al.
Free radical biology & medicine, 160, 820-836 (2020-09-21)
Brahma-related gene 1 (BRG1) regulates the chromatin structure and expression of cardiac genes. Although BRG1 is downregulated in adult cardiomyocytes, it is reactivated during cardiac stress. The role of BRG1 in acute myocardial infarction (AMI) has not been clearly defined.
Yanru Li et al.
Journal of biochemical and molecular toxicology, 32(4), e22044-e22044 (2018-02-20)
Accumulating evidence has reported that microRNA-144-3p (miR-144-3p) is highly related to oxidative stress and apoptosis. However, little is known regarding its role in cerebral ischemia/reperfusion-induced neuronal injury. Herein, our results showed that miR-144-3p expression was significantly downregulated in neurons following

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique