Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU075731

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXO4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
292,00 $
50 μG
534,00 $

292,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
292,00 $
50 μG
534,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

292,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAGCTCTTGGTGGATGCTGAACCCTGAGGGAGGCAAGAGCGGCAAAGCCCCCCGCCGCCGGGCCGCCTCCATGGATAGCAGCAGCAAGCTGCTCCGGGGCCGCAGTAAAGCCCCCAAGAAGAAACCATCTGTGCTGCCAGCTCCACCCGAAGGTGCCACTCCAACGAGCCCTGTCGGCCACTTTGCCAAGTGGTCAGGCAGCCCTTGCTCTCGAAACCGTGAAGAAGCCGATATGTGGACCACCTTCCGTCCACGAAGCAGTTCAAATGCCAGCAGTGTCAGCACCCGGCTGTCCCCCTTGAGGCCAGAGTCTGAGGTGCTGGCGGAGGAAATACCAGCTTCAGTCAGCAGTTATGCAGGGGGTGTCCCTCCCACCCTCAATGAAGGTCTAGAGCTGTTAGATGGGCTCAATCTCACCTCTTCCCATTCCCTGCTATCTCGGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nikolaos Doumpas et al.
The EMBO journal, 38(2) (2018-11-15)
During canonical Wnt signalling, the activity of nuclear β-catenin is largely mediated by the TCF/LEF family of transcription factors. To challenge this view, we used the CRISPR/Cas9 genome editing approach to generate HEK 293T cell clones lacking all four TCF/LEF
Linna Su et al.
BMC cancer, 14, 378-378 (2014-06-03)
FOXO4, a member of the FOXO family of transcription factors, is currently the focus of intense study. Its role and function in gastric cancer have not been fully elucidated. The present study was aimed to investigate the expression profile of
Yanying Liu et al.
Human molecular genetics, 26(22), 4416-4428 (2017-10-04)
Although it has been speculated that proteasome dysfunction may contribute to the pathogenesis of Huntington's disease (HD), a devastating neurodegenerative disorder, how proteasome activity is regulated in HD affected stem cells and somatic cells remains largely unclear. To better understand
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique