Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU072741

Sigma-Aldrich

MISSION® esiRNA

targeting human RORA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTGCCTTTGACTCTCAGAACAACACCGTGTACTTTGATGGGAAGTATGCCAGCCCCGACGTCTTCAAATCCTTAGGTTGTGAAGACTTTATTAGCTTTGTGTTTGAATTTGGAAAGAGTTTATGTTCTATGCACCTGACTGAAGATGAAATTGCATTATTTTCTGCATTTGTACTGATGTCAGCAGATCGCTCATGGCTGCAAGAAAAGGTAAAAATTGAAAAACTGCAACAGAAAATTCAGCTAGCTCTTCAACACGTCCTACAGAAGAATCACCGAGAAGATGGAATACTAACAAAGTTAATATGCAAGGTGTCTACCTTAAGAGCCTTATGTGGACGACATACAGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTTCATTTTCCTCCATTATACAAGGAGTTGTTCACTTCAGAATTTGAGCCAGCAATGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hao Hu et al.
The Biochemical journal, 477(18), 3583-3598 (2020-07-21)
Estrogen sulfotransferase (SULT1E1) metabolically inactivates estrogen and SULT1E1 expression is tightly regulated by multiple nuclear receptors. Human fetal, but not adult, livers express appreciable amounts of SULT1E1 protein, which is mimicked in human hepatoma-derived HepG2 cells cultured in high glucose
Hongyu Li et al.
Journal of cellular physiology, 233(1), 641-650 (2017-03-24)
Low O2 pressures present in the microenvironment of epidermis control keratinocyte differentiation and epidermal barrier function through hypoxia inducible factors (HIFs) dependent gene expression. This study focuses on investigating relations of the retinoic acid receptor-related orphan receptor alpha (RORα) to
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Dongli Liu et al.
Scientific reports, 10(1), 13906-13906 (2020-08-19)
ROR1 and ROR2 are receptor tyrosine kinases with altered expression in a range of cancers. Silencing ROR1 or ROR2 in different tumour types has been shown to inhibit proliferation and decrease metastatic potential. The aim of this study was to
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique