Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU071641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Hiroki Satooka et al.
Molecular and cellular biology, 36(7), 1206-1218 (2016-02-03)
Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3
Mariko Hara-Chikuma et al.
Biochemical and biophysical research communications, 471(4), 603-609 (2016-02-21)
Aquaporin 3 (AQP3), a water/glycerol channel protein, is capable of transporting hydrogen peroxide (H2O2). Here, we show that AQP3-mediated intracellular H2O2 is involved in epidermal growth factor (EGF)-induced cell signaling and its dependent cell function in the EGF receptor (EGFR)-positive
Ayah E Ahmad et al.
International journal of oncology, 56(4), 1014-1024 (2020-04-23)
Estrogen receptor (ER)‑silenced breast cancer cell lines exhibit endocrine resistance and morphological changes from an epithelial to a mesenchymal phenotype. These cells also display increased motility and invasive properties that are further accentuated by exposure to an alkaline pH, exhibiting
Ya-Jing Tan et al.
Scientific reports, 5, 17741-17741 (2015-12-05)
Hyperosmotic stress may induce apoptosis of different cells. However, oocytes show tolerance to osmotic stress during cryopreservation by vitrification, which is an assisted reproductive technique. The underlying mechanism is still not understood. Here, we demonstrated that hyperosmosis produced by high

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique