Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU071391

Sigma-Aldrich

MISSION® esiRNA

targeting human SIAH1, LONP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTAATGCCCCATCTGATGCATCAGCATAAGTCCATTACAACCCTACAGGGAGAGGATATAGTTTTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTGATGATGCAGTCCTGTTTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACCAGCAGTTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGACTTGAGCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCATGAAGGAATTGCAACAGCCATTATGAATAGCGACTGTCTAGTCTTTGACACCAGCATTGCACAGCTTTTTGCAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management
Yang He et al.
Molecular cancer research : MCR, 17(5), 1129-1141 (2019-02-24)
Patients suffering from glioblastoma have a dismal prognosis, indicating the need for new therapeutic targets. Here we provide evidence that the DNA damage kinase HIPK2 and its negative regulatory E3-ubiquitin ligase SIAH1 are critical factors controlling temozolomide-induced cell death. We
Sujeong Yeom et al.
The Journal of general virology, 98(7), 1774-1784 (2017-07-18)
The seven in absentia homologue 1 (Siah-1) protein is an E3 ubiquitin ligase that induces ubiquitin-dependent proteasomal degradation of HBx, the principal regulatory protein of hepatitis B virus (HBV); however, its role in HBV propagation remains unknown. Here, we found

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique