Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU070971

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGCCCTGGTAATGTCTGCATTCAACAATGACGCTGGCTTTGTGGCTGCTCTTGATAAGGCTTGTGGTCGCTTCATAAACAACAACGCGGTTACCAAGATGGCCCAATCATCCAGTAAATCCCCTGAGTTGCTGGCTCGATACTGTGACTCCTTGTTGAAGAAAAGTTCCAAGAACCCAGAGGAGGCAGAACTAGAAGACACACTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAAGACAAAGACGTATTTCAGAAGTTCTATGCGAAGATGCTCGCCAAGAGGCTCGTCCACCAGAACAGTGCAAGTGACGATGCCGAAGCCAGCATGATCTCCAAGTTAAAGCAAGCTTGCGGGTTCGAGTACACCTCTAAACTTCAGCGCATGTTTCAAGACATTGGCGTGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yue-Chao Fan et al.
Medical oncology (Northwood, London, England), 31(10), 227-227 (2014-09-10)
This study was designed to explore the role of Cullin1 (Cul1) in the pathogenesis of human glioma and to investigate the role of Cul1 in the growth, migration and invasion of glioma cells. Expression of Cul1 in 191 glioma tissues
Yan Zhou et al.
BMC cancer, 16(1), 818-818 (2016-10-23)
Triple-negative breast cancer (TNBC) has aggressive progression with poor prognosis and ineffective treatments. Selumetinib is an allosteric, ATP-noncompetitive inhibitor of MEK1/2, which has benn known as effective antineoplastic drugs for several malignant tumors. We hypothesized that Selumetinib might be potential
Ye-Fei Huang et al.
Cell death & disease, 10(1), 2-2 (2018-12-24)
CUL1 is an essential component of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex. Our previous study has showed that CUL1 is positively associated with poor overall and disease-specific survival of breast cancer patients. Here, we further explored its roles in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique