Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU070441

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAAGATATTCGCCAGGAGTATCGAGAGGACTTTGTGCTCACCGTGACTGGCAAGAAGCACCCGTGCTGTGTCTTATCCAATCCCGACCAGAAGGGTAAGATTAGGAGAATCGACTGCCTGCGACAGGCAGACAAAGTCTGGCGTCTGGATCTAGTCATGGTGATCCTGTTCAAAGGCATCCCCTTGGAAAGTACCGATGGAGAGCGGCTCATGAAATCCCCACATTGCACAAACCCAGCACTTTGTGTCCAGCCACATCATATCACAGTATCAGTTAAGGAGCTTGATTTGTTTTTGGCATACTACGTGCAGGAGCAAGATTCTGGACAATCAGGAAGTCCAAGCCACAATGATCCTGCCAAGAATCCTCCAGGTTACCTTGAGGATAGTTTTGTAAAATCTGGAGTCTTCAATGTATCAGAACTTGTAAGAGTATCCAGAACGCCCATAACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Q-Y Liu et al.
European review for medical and pharmacological sciences, 24(13), 7266-7275 (2020-07-25)
Long non-coding RNAs (lncRNAs) have been found to exert specific functions in the progression of ovarian cancer (OC), except for lncRNA-OIP5-AS1. In this study, we aim at exploring the molecular mechanisms of OIP5-AS1 in OC. The expression levels of OIP5-AS1
Jing Chen et al.
Viruses, 7(10), 5539-5552 (2015-10-30)
Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host's immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the
Anna Yu-Szu Huang et al.
Neuron, 106(6), 992-1008 (2020-04-23)
Astrocytes play essential roles in brain function by supporting synaptic connectivity and associated circuits. How these roles are regulated by transcription factors is unknown. Moreover, there is emerging evidence that astrocytes exhibit regional heterogeneity, and the mechanisms controlling this diversity

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique