Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU067991

Sigma-Aldrich

MISSION® esiRNA

targeting human CNKSR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Le tarif et la disponibilité ne sont pas disponibles actuellement.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGACACACGCTCTACTGGTACCGCCAGCCCCAGGATGAGAAGGCTGAGGGCCTCATCAATGTCTCCAACTATAGTCTGGAAAGTGGACATGATCAGAAGAAGAAATATGTGTTTCAGCTCACCCATGATGTGTACAAACCCTTCATCTTCGCTGCTGATACCCTGACAGATCTGAGCATGTGGGTGCGTCATCTCATTACCTGCATCTCCAAGTACCAGTCTCCAGGCCGGGCCCCCCCACCCCGAGAGGAAGACTGCTACAGTGAGACCGAAGCAGAGGACCCGGACGATGAGGCTGGGTCCCACTCAGCCTCGCCCAGCCCTGCTCAAGCTGGGAGTCCCCTCCATGGAGACACATCACCTGCAGCCACCCCCACACAGCGCAGCCCACGGACCTCCTTTGGCTCTCTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Adrian Fischer et al.
Scientific reports, 6, 38155-38155 (2016-12-03)
Scaffold proteins such as the multidomain protein CNK1 orchestrate the signalling network by integrating and controlling the underlying pathways. Using an optogenetic approach to stimulate CNK1 uncoupled from upstream effectors, we identified selective clusters of CNK1 that either stimulate RAF-MEK-ERK
Martin Indarte et al.
Cancer research, 79(12), 3100-3111 (2019-05-02)
Cnk1 (connector enhancer of kinase suppressor of Ras 1) is a pleckstrin homology (PH) domain-containing scaffold protein that increases the efficiency of Ras signaling pathways, imparting efficiency and specificity to the response of cell proliferation, survival, and migration. Mutated KRAS

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique