Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU067431

Sigma-Aldrich

MISSION® esiRNA

targeting human HP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Le tarif et la disponibilité ne sont pas disponibles actuellement.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGGCTCATCAAACTCAAACAGAAGGTGTCTGTTAATGAGAGAGTGATGCCCATCTGCCTACCTTCAAAGGATTATGCAGAAGTAGGGCGTGTGGGTTATGTTTCTGGCTGGGGGCGAAATGCCAATTTTAAATTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAAGACCAATGCATAAGGCATTATGAAGGCAGCACAGTCCCCGAAAAGAAGACACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAATGAACACACCTTCTGTGCTGGCATGTCTAAGTACCAAGAAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACACCTGGTATGCGACTGGGATCTTAAGCTTTGATAAGAGCTGTGCTGTGGCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique