Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU067071

Sigma-Aldrich

MISSION® esiRNA

targeting human CRKL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCTGTCTCAGCACCCAACCTGCCTACAGCAGAAGATAACCTGGAATATGTACGGACTCTGTATGATTTTCCTGGGAATGATGCCGAAGACCTGCCCTTTAAAAAGGGTGAGATCCTAGTGATAATAGAGAAGCCTGAAGAACAGTGGTGGAGTGCCCGGAACAAGGATGGCCGGGTTGGGATGATTCCTGTCCCTTATGTCGAAAAGCTTGTGAGATCCTCACCACACGGAAAGCATGGAAATAGGAATTCCAACAGTTATGGGATCCCAGAACCTGCTCATGCATACGCTCAACCTCAGACCACAACTCCTCTACCTGCAGTTTCCGGTTCTCCTGGGGCAGCAATCACCCCTTTGCCATCCACACAGAATGGACCTGTCTTTGCGAAAGCAATCCAGAAAAGAGTACCCTGTGCTTATGACAAGACTGCCTTGGCATTAGAGGTTGGTGACATCGTGAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuehai Bian et al.
Biochemical pharmacology, 147, 30-37 (2017-11-21)
Although histone deacetylase (HDAC) inhibitors have been shown to effectively induce the inhibition of proliferation and migration in breast cancer, the anticancer mechanism remains poorly understood. Our studies show that miR-200c was significantly downregulated in breast cancer cell lines compared
Junqing Wang et al.
PloS one, 11(11), e0166147-e0166147 (2016-11-16)
SLC7A5, who is also named LAT-1, has been validated as a promoter regulated by miRNA-126 in our previous research for gastric cancer cells. However, the mechanisms driving SLC7A5 to affect the bio-function of gastric cancer cells are unclear, remaining us

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique