Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU065641

Sigma-Aldrich

MISSION® esiRNA

targeting human CCDC6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATCCAAGCCAGGGCTGAGCAGGAAGAAGAATTCATTAGTAACACTTTATTCAAGAAAATTCAGGCTTTGCAGAAGGAGAAAGAAACCCTTGCTGTAAATTATGAGAAAGAAGAAGAATTCCTCACTAATGAGCTCTCCAGAAAATTGATGCAGTTGCAGCATGAGAAAGCCGAACTAGAACAGCATCTTGAACAAGAGCAGGAATTTCAGGTCAACAAACTGATGAAGAAAATTAAAAAACTGGAGAATGACACCATTTCTAAGCAACTTACATTAGAACAGTTGAGACGGGAGAAGATTGACCTTGAAAATACATTGGAACAAGAACAAGAAGCACTAGTTAATCGCCTCTGGAAAAGGAT

Numéro d'accès Ensembl | humain

ENSG00000108091

Numéro d'accès NCBI

NM_005436

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CCDC6(8030) , CCDC6(8030)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Francesco Morra et al.
Lung cancer (Amsterdam, Netherlands), 135, 56-65 (2019-08-27)
CCDC6 (coiled-coil domain containing 6) is a player of the HR response to DNA damage and has been predicted to interact with BAP1, another HR-DNA repair gene highly mutated in Malignant Pleural Mesothelioma (MPM), an aggressive cancer with poor prognosis.
Francesco Morra et al.
Oncotarget, 8(19), 31815-31829 (2017-04-19)
Reduced levels of the tumor suppressor protein CCDC6 sensitize cancer cells to the treatment with PARP-inhibitors. The turnover of CCDC6 protein is regulated by the de-ubiquitinase USP7, which also controls the androgen receptor (AR) stability. Here, we correlated the expression
Francesco Morra et al.
Oncotarget, 6(14), 12697-12709 (2015-04-18)
CCDC6 gene product is a pro-apoptotic protein substrate of ATM, whose loss or inactivation enhances tumour progression. In primary tumours, the impaired function of CCDC6 protein has been ascribed to CCDC6 rearrangements and to somatic mutations in several neoplasia. Recently

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique