Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU063351

Sigma-Aldrich

MISSION® esiRNA

targeting human WHSC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCACCATACAAGCACATCAAGGTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAGTGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGGATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAGTGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGGGGCCTGGTCGCCAAGAGGGACATCAGAAAGGGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGAATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAGGACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGCCAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nicole M A White-Al Habeeb et al.
The Prostate, 76(16), 1507-1518 (2016-10-19)
This study explored the biological effects of metformin on prostate cancer (PCa) cells and determined molecular pathways and epigenetic regulators implicated in its mechanism of action. We performed mRNA expression profiling in 22Rv1 cells following 2.5 mM and 5 mM metformin treatment.
Liang-Yan Chen et al.
The Journal of pathology, 248(1), 103-115 (2019-01-23)
Liver metastasis is the main cause of death in patients with colorectal cancer (CRC). Here, we searched for CRC metastasis-associated circular RNA in a mouse model of liver metastasis of CRC by using RNA (transcriptome)-sequencing. We identified a novel and
Jin Woo Park et al.
Scientific reports, 5, 12485-12485 (2015-07-25)
Histone lysine methylation contributes to transcriptional regulation by serving as a platform for the recruitment of various cofactors. Intense studies have been conducted for elucidating the functional meaning of H3K79 methylation, and to date, the only known HMTase responsible for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique