Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU063211

Sigma-Aldrich

MISSION® esiRNA

targeting human LETM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAGTTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTGCCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCCACATTTGAGACTCAGTCACTCAAGGAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGACACCATCGAGGAGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lihua Piao et al.
Cancer management and research, 12, 1649-1660 (2020-03-19)
The leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is a mitochondrial protein that has been associated with the occurrence and development of malignant tumors. Previous studies have shown that LETM1 expression is increased in several types of human cancer and
Haoyue Li et al.
Experimental and molecular pathology, 112, 104333-104333 (2019-11-11)
Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is closely linked to the occurrence and development of many malignant tumors. Many studies have reported that enhanced expression of LETM1 in several types of human cancers was associated with poor clinical outcomes;
Lesley Hart et al.
Disease models & mechanisms, 7(5), 535-545 (2014-03-15)
Wolf-Hirschhorn syndrome (WHS) represents an archetypical example of a contiguous gene deletion disorder - a condition comprising a complex set of developmental phenotypes with a multigenic origin. Epileptic seizures, intellectual disability, growth restriction, motor delay and hypotonia are major co-morbidities

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique