Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU059361

Sigma-Aldrich

MISSION® esiRNA

targeting human GFI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGACACAAATAGGCTCCTCTACACCTGAAGACAAAGGCAAAGTCAAATGGGGACCAGAATAAATCTTAGACCCCACAGTCCTTCCCATTTCCAGCCCTAATCTACAGACAGGAATGCCCTTCAGGTTTCTTCCCTCCCCCCTCTTGACCTACCCCAGATATTTGTGTGGAAGAGGAGGAATCACCATTTACAAGGTGGACAAATGCTAATATTTTTATCTAGAAAGAAGAGTGAGTGTTAACTTTTATTTTTTTCCTTCTGGGGGGTCTGTTGACTCCTTTCTTTTGGGTGCTGCCTATAAATCTTGGAGGAATCATTTCTCCTCCTCAAAAACTGATTCAGAAACTGACTTGGGGAAGGAATTTAATACTTTGAAGTCATGAGATGCACCATCGAGGCTACCCCCAAGAAGAAGCAGA

Numéro d'accès Ensembl | humain

ENSG00000162676

Numéro d'accès NCBI

NM_005263

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GFI1(2672) , GFI1(2672)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Giacomo Volpe et al.
Scientific reports, 7(1), 11148-11148 (2017-09-13)
Growth Factor Independence 1 (GFI1) is a transcriptional repressor that plays a critical role during both myeloid and lymphoid haematopoietic lineage commitment. Several studies have demonstrated the involvement of GFI1 in haematological malignancies and have suggested that low expression of
Hongbing Cai et al.
Cancer management and research, 10, 2849-2857 (2018-09-11)
The independent growth factor 1 (Gfi-1) is a transcription factor essential for several diverse hematopoietic functions and developments. However, the role and molecular mechanism of Gfi-1 in the development and progression of cervical cancer remains unclear. The present study investigates
Juraj Adamik et al.
Molecular cancer research : MCR, 15(4), 405-417 (2017-01-26)
In multiple myeloma, osteolytic lesions rarely heal because of persistent suppressed osteoblast differentiation resulting in a high fracture risk. Herein, chromatin immunoprecipitation analyses reveal that multiple myeloma cells induce repressive epigenetic histone changes at the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique