Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU056571

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTATCCTCGTGGACTGGTTAGTTGAAGTAGGAGAAGAATATAAACTACAGAATGAGACCCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGTCTTCCATGTCAGTGCTGAGAGGAAAACTTCAGCTTGTGGGCACTGCTGCTATGCTGTTAGCCTCAAAGTTTGAAGAAATATACCCCCCAGAAGTAGCAGAGTTTGTGTACATTACAGATGATACCTACACCAAGAAACAAGTTCTGAGAATGGAGCATCTAGTTTTGAAAGTCCTTACTTTTGACTTAGCTGCTCCAACAGTAAATCAGTTTCTTACCCAATACTTTCTGCATCAGCAGCCTGCAAACTGCAAAGTTGAAAGTTTAGCAATGTTTTTGGGAGAATTAAGTTTGATAGATGCTGACCCATACCTCAAGTATTTGCCATCAGTTATTGCTGGAGCTGCCTTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fei Guo et al.
International journal of oncology, 57(1), 264-276 (2020-05-08)
Ovarian cancer is the most lethal gynecological tumor, and the 5‑year survival rate is only ~40%. The poor survival rate is due to cancer diagnosis at an advanced stage, when the tumor has metastasized. A better understanding of the molecular pathogenesis
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Patrick E Gygli et al.
Aging, 8(7), 1540-1570 (2016-07-19)
Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique