Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU055781

Sigma-Aldrich

MISSION® esiRNA

targeting human LATS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGCCTTGCTTGTAAGGTGGACACTCACGCCCTGTACGCCATGAAGACCCTAAGGAAAAAGGATGTCCTGAACCGGAATCAGGTGGCCCACGTCAAGGCCGAGAGGGACATCCTGGCCGAGGCAGACAATGAGTGGGTGGTCAAACTCTACTACTCCTTCCAAGACAAAGACAGCCTGTACTTTGTGATGGACTACATCCCTGGTGGGGACATGATGAGCCTGCTGATCCGGATGGAGGTCTTCCCTGAGCACCTGGCCCGGTTCTACATCGCAGAGCTGACTTTGGCCATTGAGAGTGTCCACAAGATGGGCTTCATCCACCGAGACATCAAGCCTGATAACATTTTGATAGATCTGGATGGTCACATTAAACTCACAGATTTCGGCCTCTGCACTGGGTTCAGGTGGACTCACAATTCCAAATATTACCAGAAAGGGAGCCATG

Numéro d'accès Ensembl | humain

ENSG00000150457

Numéro d'accès NCBI

NM_014572

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LATS2(26524) , LATS2(26524)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cong Dong et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(6), 475-481 (2015-03-19)
Many reports indicated LATS2 was a component of the Hippo pathway, could phosphorylate and inactivate YAP, acted as a tumor suppressor in human cancers. But few studies investigated the role of LATS2 in oral squamous cell carcinoma (OSCC) and clarified
Cédric Belair et al.
Silence, 2(1), 7-7 (2011-10-27)
MicroRNAs, post-transcriptional regulators of eukaryotic gene expression, are implicated in host defense against pathogens. Viruses and bacteria have evolved strategies that suppress microRNA functions, resulting in a sustainable infection. In this work we report that Helicobacter pylori, a human stomach-colonizing
Ke Wang et al.
International journal of molecular medicine, 47(4) (2021-02-13)
Long non‑coding RNAs (lncRNAs) are a class of non‑protein coding transcripts that are involved in the regulation of gene expression in mammalian cells. Transcriptional co‑activator Yes associated protein 1 (YAP1) plays a key role in the progression of ovarian cancer.
Tone B Enger et al.
Laboratory investigation; a journal of technical methods and pathology, 93(11), 1203-1218 (2013-10-02)
Sjogren's syndrome (SS) is a complex autoimmune disease that primarily affects salivary and lacrimal glands and is associated with high morbidity. Although the prevailing dogma is that immune system pathology drives SS, increasing evidence points to structural defects, including defective
Chiara Verdelli et al.
Endocrine-related cancer, 25(7), 761-771 (2018-05-05)
Parathyroid tumors deregulate microRNAs belonging to the two clusters on the chromosome 19, the C19MC and miR-371-373 clusters. Here, we report that the embryonic miR-372 is aberrantly expressed in half of parathyroid adenomas (PAds) in most of atypical adenomas and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique