Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU053231

Sigma-Aldrich

MISSION® esiRNA

targeting human CD38

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshio Ogura et al.
Aging, 12(12), 11325-11336 (2020-06-09)
Mitochondrial oxidative stress is a significant contributor to the pathogenesis of diabetic kidney disease (DKD). We previously showed that mitochondrial oxidative stress in the kidneys of Zucker diabetic fatty rats is associated with a decreased intracellular NAD+/NADH ratio and NAD+-dependent
Cheng-Bo Song et al.
Journal of translational medicine, 18(1), 95-95 (2020-02-26)
Despite the effective antiretroviral treatment (ART) of HIV-infected individuals, HIV persists in a small pool. Central memory CD4+ T cells (Tcm) make a major contribution to HIV persistence. We found that unlike HLA-DR, CD38 is highly expressed on the Tcm
Longfei Gao et al.
Frontiers in cellular neuroscience, 13, 316-316 (2019-07-23)
Mitochondria are the critical organelles for energy metabolism and cell survival in eukaryotic cells. Recent studies demonstrated that mitochondria can intercellularly transfer between mammalian cells. In neural cells, astrocytes transfer mitochondria into neurons in a CD38-dependent manner. Here, using co-culture

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique